Abstract
Although the gene MEN1 has a long-standing association with cancer, its mechanisms of action remain incompletely understood, acting both as a tumour suppressor in neuroendocrine tumours and as an oncogene in leukaemia. The best-characterised isoform of the encoded protein, MENIN, is the 610-amino acid MENIN isoform 2. We hypothesise that some of the complexity of MEN1 biology can be attributed to a currently unappreciated contribution of different MENIN isoforms. Through in silico data mining, we show alternative splicing along the entire length of MEN1. Splice junction data suggest that the transcript encoding MENIN isoform 2 is the most abundant in all tissues examined, making a strong argument for this to be the reference transcript/protein isoform of MEN1. We also report novel splicing events, including a novel exon from within intron 7 that is relatively highly expressed in many tissues. These splicing events are predicted to contribute to MENIN diversity by generating isoforms with in-frame insertions, deletions or unique amino termini that, in turn, could have altered interactions with partner proteins. Finally, we have compiled 2574 unique genomic variants reported in MEN1 within somatic and germline databases and have identified several variants that could impact individual MENIN isoforms. We have also collated studies pertinent to MENIN function in the literature and summarised the impact of MEN1 variants on 74 biological variables. We propose a set of four MEN1 variants, MENINL22R, MENINH139D, MENINA242V and MENINW436R, that represent a cohort with different biological properties, which should be investigated concurrently to better dissect MENIN function.
Introduction
Mutations in the gene MEN1, which encodes the protein MENIN, are causal in multiple endocrine neoplasia 1 (MEN1) syndrome (OMIM: 131100). Nevertheless, MEN1 remains enigmatic, almost 30 years after its cloning. MEN1 syndrome is notable for the development of neuroendocrine tumours (NETs), usually adenomas, with an autosomal dominant pattern of inheritance and high penetrance in the parathyroid, anterior pituitary, adrenal cortex and pancreatic islets, although other endocrine and neuroendocrine cell types can also be involved (Thakker 2010). With positional cloning to chromosome 11 (Larsson et al. 1988) and refinement of the locus to MEN1 (Chandrasekharappa et al. 1997), it was immediately recognised that the causal gene likely encoded a tumour suppressor in NETs, with loss of heterozygosity of the wild-type allele unmasking a mutant allele that was non-functional, or only partially functional, in associated tumours. This has been borne out in larger MEN1 syndrome cohorts as well as in sporadic NETs, including gastrinomas, pancreatic neuroendocrine tumours (pNETs), pituitary and parathyroid tumours (Patel et al. 1990, Heppner et al. 1997, Zhuang et al. 1997a,b, Hessman et al. 1998, Wang et al. 1998). We, and others, have recently shown that the loss of MEN1, in the context of a defined copy number change signature, may identify a subset of pNETs with poorer prognosis (Scarpa et al. 2017, Lawrence et al. 2018).
The most widely studied isoform of the encoded protein, MENIN, is derived from a 10-exon transcript (representative transcript NM_001370259.2) with an open reading frame (ORF) that translates to a 610-amino acid protein (MENIN isoform 2) (Chandrasekharappa et al. 1997). The first characterised function of MENIN was its physical association with the transcription factor JUND, along with concomitant repression of JUND-dependent reporter gene expression (Agarwal et al. 1999). MENIN can also immunoprecipitate with the Set1-like lysine methyl transferases KMT2A (also known as mixed lineage leukaemia 1 (MLL1)) and KMT2B (Yokoyama et al. 2004, 2005, Milne et al. 2005). Part of the COMPASS-like protein complexes, KMT2A/B are responsible for the trimethylation of histone 3 on lysine 4 (H3K4me3) at a subset of genomic loci, thereby facilitating transcription by promoting DNA accessibility (Cenik and Shilatifard 2021). Rearrangements involving KMT2A are observed in a subset of acute and mixed lineage leukaemia, including over 70% of childhood leukaemia (Milan et al. 2022). Critically, balanced translocations create KMT2A fusion proteins that have lost the methyltransferase domain of KMT2A but retain the MENIN binding motif. The central role of MENIN in establishing the oncogenic functions of KMT2A fusion proteins is evident from the observation that it is the only COMPASS component that is indispensable for KMT2A-driven HOX gene expression (Yokoyama et al. 2004) and leukaemogenesis (Yokoyama et al. 2005).
The role of MENIN as a tumour suppressor, while equally important, is less clearly defined. Although homozygous deletion of Men1 in mice is embryonic lethal (Crabtree et al. 2001), heterozygous Men1+/− mice develop tumours in a range of tissues, including the pituitary, adrenal cortex, lung, parathyroid and pancreas (Crabtree et al. 2001, Bertolino et al. 2003a, Loffler et al. 2007, Harding et al. 2009), phenocopying MEN1 syndrome in man. Furthermore, targeted deletion of Men1 in the parathyroid (Libutti et al. 2003) and in various cell types of the pancreas (Crabtree et al. 2003, Bertolino et al. 2003b, Biondi et al. 2004, Lu et al. 2010, Shen et al. 2009, 2010, Li et al. 2015) results in hyperproliferation and adenomas in these tissues. Mechanistically, deregulated cell cycle control has been implicated in the increased proliferation of these tumours – the cell cycle inhibitors (CDKis) Cdkn1b and Cdkn2c are transcriptional targets of KMT2A and MENIN, and the expression of the CDKis Cdkn1b, Cdkn2c, Cdkn1a and Cdkn2b is decreased in pancreatic tumours (Milne et al. 2005, Karnik et al. 2005, Schnepp et al. 2006). In addition, the deletion of Cdk4 completely prevents islet and anterior pituitary hyperplasia in Men1+/− mice (Gillam et al. 2015). However, altered cell cycle control is unlikely to be the sole contributor to tumourigenesis, as changes in CDKi expression occur after the onset of pancreatic islet hyperplasia following acute deletion of Men1 in mice (Schnepp et al. 2006, Yang et al. 2010) . In addition, targeted deletion of Men1 in the liver leads to decreased expression of Cdkn1b and Cdkn2c but not tumour formation in this organ (Scacheri et al. 2004, 2006). Finally, the propensity for islet β-cell tumour development, regardless of the pancreatic cell type in which Men1 is deleted, suggests an unresolved role for MENIN in cell identity (Shen et al. 2009, 2010, Lu et al. 2010).
How diverse MEN1 variants in MEN1 syndrome and cancer generate different structural and functional alterations in MENIN, yet converge on its tumour-suppressive role in NETs, remains unknown. In addition, although MENIN interacts with many cellular proteins, it does not possess any discernible functional domains apart from nuclear localisation (Guru et al. 1998, La et al. 2006) and export (Cao et al. 2009) signals. Such fundamental knowledge gaps and ambiguities have led to an incomplete understanding of the basic biology of MEN1, compounding the difficulty in reconciling MENIN’s roles as both an oncogene and tumour suppressor in cancer. Here, we have used in silico data mining, gene expression analysis and literature searches to investigate the role of MEN1 isoforms in cell function.
Materials and methods
MEN1 expression and splicing from GTEx
The Genotype-Tissue Expression (GTEx) portal (GTEx Analysis Release V8 (dbGaP Accession phs000424.v8.p2)) was interrogated with the search term ‘MEN1’ as the gene ID. Organ expression profile and exon junction expression data of MEN1 were downloaded on 3 July 2023, with four tissues (brain – cerebellar hemisphere, brain – frontal cortex (BA9), cells – EBV-transformed lymphocytes and cells – cultured fibroblasts) excluded. Biological sex-specific expression data was downloaded on 18 July 2023. The GTEx Project was supported by the Common Fund of the Office of the Director of the National Institutes of Health, and by NCI, NHGRI, NHLBI, NIDA, NIMH and NINDS. MEN1 reference sequences were obtained from GenBank and Ensembl (build 109) on 7 July 2023. Splice junctions of reference transcripts were determined by alignment to the MEN1 reference gene (LRG_509; NG_008929.1) using BLAST. Expressed sequence tags (ESTs) were inspected in the University of California Santa Cruz (UCSC) Genome Browser.
MENIN isoform prediction
Putative ORFs in MEN1 were identified in inferred full-length MEN1 transcripts using Open Reading Frame Finder (National Library of Medicine).
Curation of MEN1 variants
cBioPortal, COSMIC, LOVD and ClinVar were queried between 23rd June 2023 and 27th June 2023 for this study. In cBioPortal, the gene ‘MEN1’ was queried in all available studies (n = 379), equating to 190,354 samples from 181,665 patients, and all resultant data were downloaded. In COSMIC, the gene ‘MEN1’ was queried in all available studies, equating to 23,245 samples, and all resultant data were downloaded. From LOVD and ClinVar, all variants pertaining to the gene ‘MEN1’ were downloaded. For data from cBioPortal, COSMIC and LOVD, the data were consolidated to ensure there were no duplicate entries of the same variant within each dataset (Supplementary Fig. 4A). For ClinVar, only variants with the following clinical significance were retained – conflicting interpretations of pathogenicity, liikely pathogenic, pathogenic, pathogenic/likely pathogenic and uncertain significance. Variant Validator (Freeman et al. 2018) was used to obtain HGVS-compliant variant descriptions pertinent to the following references – human genome 38 (hg38), NM_001370259.2, NP_001357188.2, NM_000244.3, NP_000235.2, NM_001370251.2 and NP_001357180.2. Finally, Variant Validator output data across all three databases were consolidated to ensure there were no duplicate entries for the same variant, resulting in 2575 unique MEN1 variants (Supplementary Fig. 4A). Genomic coordinates were then uploaded into Variant Effect Predictor (Martin et al. 2023) to predict the effect on the gene (e.g. 5′UTR variant, frameshift variant).
Review of the literature
Literature searches were performed in PubMed on 14th August 2023. First, the search term ‘MEN1’ was used to capture literature relevant to MEN1, and returned 4051 papers. Next, the search term ‘MENIN NOT MEN1’ was used to capture literature pertinent to MENIN, excluding those that would already have been captured with the search term ‘MEN1’; this returned 521 papers. Thus, a total of 4572 papers were retrieved, relevant to MEN1 and its encoded protein, MENIN. The abstracts of all papers were evaluated for mentions of MENIN-interacting proteins and/or MENIN mutants and biological function. Forty-seven papers were reviewed in full to determine the methodologies used for protein–protein interactions and the effects of MEN1 variants on protein function.
RNA extraction and reverse transcription
HEK293T cells (150,000 cells per well of a 6-well plate) were plated in 2 mL of complete culture media (DMEM (Thermo Fisher Scientific) supplemented with 10% fetal calf serum (Thermo Fisher Scientific) and 1% penicillin/streptomycin (Thermo Fisher Scientific)) for 48 h. RNA was extracted from the cells using Trizol (Ambion/Thermo Fisher Scientific) as per the manufacturer’s instructions. Five hundred ng of RNA was reverse transcribed to cDNA with AffinityScript Reverse Transcriptase (Agilent) as per the manufacturer’s instructions. Amplification of the region spanning exons 7 and 8 of MEN1 was performed with the following primers: hMEN1_Ex7_8_screen_F: GCCAAGACCTACTATCGGGA, hMEN1_Ex7_8_screen_R: AGCAGGTTGGGGATGACATC. PCR was performed with Taq polymerase (Qiagen) with an annealing temperature of 54°C for 35 cycles on a Veriti Thermocycler (Applied Biosystems). PCR products were separated by electrophoresis on a 2% agarose gel. Bands were gel extracted and cloned into pGEM-T Easy (Promega) for Sanger sequencing. Sequences were then aligned to LRG_509 to deduce splice junctions.
Results
MEN1 is widely expressed across human tissues
To profile the expression of MEN1 across human tissues, we explored its expression in GTEx, where gene expression data in 50 tissues from 983 individuals obtained at autopsy has been deposited (Consortium, 2013). MEN1 had broad tissue expression across both endocrine and non-endocrine tissues, with the highest expression seen in the brain cerebellum and the lowest in the left ventricle of the heart (Fig. 1A). Expression in tissues was similar between biological male and female tissue samples (Supplementary Fig. 1A).
Expression and alternative isoforms of human MEN1. (A) Expression of MEN1 across 50 human tissues, displayed as transcripts per million (TPM) and ranked by abundance. (B) Predicted MENIN ORFs (black) that generate different MENIN isoforms in representative MEN1 transcripts. Green ‘MENIN Isoform 2’: encoded by the MANE select transcript.
Citation: Endocrine Oncology 4, 1; 10.1530/EO-24-0014
MEN1 undergoes alternative splicing along the entire gene
Mapping of MEN1 reference transcripts from GenBank and Ensembl to the MEN1 reference gene revealed significant alternative splicing of MEN1 along the entire length of the gene (Supplementary Table 1). The choice of reference transcript for any gene, including MEN1, can be contentious (Nelakurti et al. 2020, Perner et al. 2023), with possibilities including the longest transcript, longest ORF, most abundant transcript, or most clinically relevant variant (Morales et al. 2022). For MEN1, the 610-amino acid MENIN protein is the most extensively studied isoform (MENIN isoform 2) and is encoded by the most abundant transcript (see below). Thus, we chose to use the MANE select transcript NM_001370259.2, corresponding to this protein isoform, as the comparator in this work. The MEN1 MANE select transcript contained ten exons, with translation predicted to initiate in exon 2 (Fig. 1B); the approximately 1.2 kilobase (kb) region upstream of the translation start site underwent extensive splicing to generate 5′ untranslated regions (UTRs) of variable length and sequence in different reference transcripts (Supplementary Fig. 1B, Supplementary Table 1).
When present in transcripts, exons 4, 5, 6, 8 and 9 were invariant. All other exons underwent alternative splicing events (Fig. 1B), with one event for exon 2 (exon 2*, representative transcript NM_000244.4), two events for exon 3 (exon 3*, representative transcript NM_001370262.2 and exon 3**, representative transcript ENST00000394374.7) and one event for exons 7 (exon 7*, representative transcript ENST00000672079.1) and 10 (exon 10*, representative transcript ENST00000394376.6) observed (Supplementary Table 1). In addition, MEN1 reference transcripts indicated the inclusion of an additional exon from within exon 7 (exon 7b, representative transcript NM_001407143.1), the skipping of exon 9 (representative transcript NM_001407152.1) and the retention of introns 3, 5–6 and 7 (Supplementary Table 1).
Alternative splicing of MEN1 occurs in vivo
It is imperative to understand whether alternative splicing of MEN1, as predicted by reference transcripts, occurs in vivo in cells and tissues, as they would potentially result in MENIN isoforms with different biological functions. Thus, we searched the UCSC Genome Browser, Genbank and GTEx for further support of alternative splicing of MEN1. The Genbank entry U93236.1 represents the first full-length ORF of MEN1 cloned from a leucocyte cDNA library (Chandrasekharappa et al. 1997). This transcript has an identical ORF to the MANE select transcript (Supplementary Table 1). The use of exon 3* was also supported by a full-length ORF (BC002544.2) cloned from a choriocarcinoma sample, as well as by ESTs. The use of exon 2* and retention of introns 3, 5–6 and 7 were supported by ESTs (Supplementary Table 1) as well as short-read sequencing, as visualised in Integrated Genomics Viewer (IGV) tracks (Fig. 2A and B).
Expression of alternatively spliced exons in MEN1. (A) IGV screenshot of RNA-seq read coverage of MEN1 in selected human tissues. (B) IGV screenshot of RNA-seq read coverage of the 3′ end of exon 2 in selected human tissues. Boundaries of exon 2 and 2* are shown in the schematic below. (C) PCR amplification by primers spanning exons 7 and 8 of MEN1 from cDNA synthesised from HEK293T RNA (+RT cDNA); Water (negative control), Genomic DNA (positive control), -RT cDNA (genomic DNA contamination of RNA). (D and E) Electropherogram traces of the 5′ and 3′ boundaries of exon 7b spliced to exons 7 and 8 respectively. RT – reverse transcriptase.
Citation: Endocrine Oncology 4, 1; 10.1530/EO-24-0014
The use of exon 7b was supported by a partial EST (BE772061) (Supplementary Table 1) obtained from a prostate tumour. While this EST captured the splicing of exon 7b to exon 8, it lacked the 5′ end of the exon (data not shown). To confirm the expression of this additional exon and to map its 5′ boundary, we probed cDNA from HEK293T cells. PCR performed using primers designed in exons 7 and 8 revealed the expression of products of varying lengths (Fig. 2C). Sanger sequencing of the approximately 210 bp fragment revealed it to represent the canonical splicing of exons 7 and 8 (data not shown). On the other hand, the approximately 320 bp fragment demonstrated splicing of exons 7, 7b and 8 (Fig. 2D and E respectively), confirming the use of exon 7b in vivo. To the best of our knowledge, the alternative splicing of exon 3**, exon 7*, exon 10* and the skipping of exon 9 are not currently supported by cloned ORFs, ESTs or short reads.
Splice junction use suggests variable expression of MEN1 transcript variants
To further understand the alternative splicing of exons and infer relative isoform abundance, we analysed GTEx for short reads supporting splice junction use in MEN1. Junctions 12, 9, 8, 7, 6, 5, 3 and 1 were the most abundant, and when used together, would give rise to the MANE select transcript (Supplementary Fig. 2). Junction 4, which supports the splicing of exon 7b to exon 8, was also broadly and relatively highly expressed across all tissues examined. Junction 11, spanning exon 2* and 3, showed a more restricted tissue distribution and lower expression compared to junction 12, where exon 2 is spliced to exon 3. The lower expression of exon 2* was also evident in IGV, where the read coverage of the extra 15 nucleotides of this alternative exon was much lower than that of the rest of the exon (Fig. 2B). Finally, junction 10, which spans exons 3* and 4, showed the most restricted tissue distribution and lowest expression (Supplementary Fig. 2) but was nevertheless clearly detectable. Alternative splicing generating exon 3**, exon 7*, exon 10* and the skipping of exon 9 are not supported by splice junction reads in GTEx at present.
Alternative splicing could generate significant diversity in MENIN isoforms
To determine the consequences of MEN1 alternative splicing on protein isoforms, we performed in silico translation and sequence alignment. The MANE select transcript is predicted to encode a single ORF, resulting in a 610 amino acid protein, MENIN isoform 2 (Supplementary Table 1, Fig. 1B and Supplementary Fig. 3). Relative to the MANE select transcript, the use of exons 2*, 3*, 7b and 10*, along with the skipping of exon 9, are all predicted to be in-frame, giving rise to protein isoforms of 615 (MENIN isoform 1), 575 (MENIN isoform 4), 652 (MENIN isoform 3), 607 (MENIN_Exon10*_Predicted_ORF) and 555 (MENIN isoform 7) amino acids, respectively (Supplementary Table 1, Fig. 1B and Supplementary Fig. 3).
Several MEN1 reference transcripts are predicted to contain multiple ORFs or encode atypical isoforms. The first ORF, when exon 3** is used, when introns 3, 5–6 or 7 are retained, or the ORF when exon 7* is used, would result in a truncated protein with unique carboxy (C) termini (Fig. 1B and Supplementary Fig. 3). However, downstream methionine residues, whether in-frame (MENIN_Retained_Intron5_6_ORF2), from within introns (MENIN_Retained_Intron3_Predicted_ORF2, MENIN_Retained_Intron7_Predicted_ORF2), or from a different reading frame (MENIN_Exon3**_Predicted_ORF2), would also result in the translation of the C-terminal of MENIN but with unique amino (N) termini (Fig. 1B and Supplementary Fig. 3).
MENIN associates with interacting partners across its entire length
Focussing on full-length isoforms supported by cloned ORFs or ESTs, we mapped the insertions and deletions in MENIN isoforms 1, 4 and 3 relative to isoform 2. The solved crystal structure of MENIN isoform 2 shows it to resemble a curved left hand composed of α-helical folds and β-sheets (Murai et al. 2011, Huang et al. 2012, Shi et al. 2012). The five-amino-acid insertion in isoform 1 is predicted to occur immediately downstream of helix α6 in the thumb domain of MENIN, while the 35-amino-acid deletion in isoform 4 would lead to the loss of the β5 and α8 in the thumb domain of MENIN (Fig. 3A). In addition, the 42-amino-acid insertion in isoform 3 is predicted to occur just downstream of α14 in the palm domain of MENIN (Fig. 3A).
Schematic of MENIN. (A) Top – crystal structure domains of MENIN isoform 2, indicating regions that contribute to the heel (orange), thumb (green), palm (dark blue) and fingers (light blue). Bottom – superimposed MENIN isoforms 1, 4 and 3. Solid purple lines – amino acids inserted in specific MENIN isoforms, dashed line – amino acids lost in specific MENIN isoforms. Note that amino acids 460-519 remain unresolved in the crystal structure of MENIN. (B) Domains of MENIN required for interaction with partner proteins. Red – domains identified by deletion mapping, pink blue bound boxes – residues identified from crystallography experiments, black (mSin3A) – putative mSin3A interacting domain identified by sequence homology and black (ASK) – interacting domain mapped from patient-derived truncated MENIN variants.
Citation: Endocrine Oncology 4, 1; 10.1530/EO-24-0014
Publications in PubMed from database inception to June 2023 were reviewed to map interacting domains on MENIN for other proteins/biomolecules. MENIN interacts with a wide spectrum of cellular partners (Supplementary Table 2) ranging from DNA, histones and chromatin modifiers to kinases, ubiquitin ligases and cytoskeletal proteins, with binding domains mapping along the entire length of MENIN (Fig. 3B). Given the protein diversity predicted by alternative splicing, MENIN isoforms 1, 3 and 4 could have altered protein–protein interactions relative to MENIN isoform 2. For instance, MENIN isoform 4 lacks a portion of the protein that interacts with partners including SMAD3 (Fig. 3B).
Most MEN1 variants are missense or lead to premature protein termination
To understand the spectrum of genomic variants in MEN1, we examined the public databases cBioPortal, COSMIC (predominantly somatic), LOVD and Clinvar (predominantly germline). About 2574 unique variants were identified across all databases post filtering (Supplementary Fig. 4 and Supplementary Table 3). Information on the origin of the allele (somatic and/or germline) was present for 2347 variants; 62% of variants were found only in the germline, 25% were somatic and 13% were found in both (Fig. 4A).
Variants identified in MEN1. (A) Source of MEN1 variant alleles reported in public databases. (B) Functional consequences of variants identified in MEN1. (C–E) Frequency distribution of variants in the genome of MEN1 around (C) exons 2 (3’) and 3 (5’), (D) exon 3 (3’) and (E) exons 7 (3’) and 8 (5’). NP_001357188.2 – MENIN isoform 2, NP_000235.2 – MENIN isoform 1, NP_001357180.2 – MENIN isoform 3.
Citation: Endocrine Oncology 4, 1; 10.1530/EO-24-0014
We next examined the types of genomic variants identified in MEN1. The majority of variants were either missense (approximately 50%) or led to frameshifts/premature protein termination (31%), with variants in intronic regions, UTRs, affecting splicing, resulting in in-frame insertions/deletions or synonymous changes varying in frequency from 1.6% to 6.6% (Fig. 4B). The proportion of missense to frameshift variants was roughly 2:1 for variants found exclusively in the germline genome and 1:1 for exclusively somatic variants (Supplementary Fig. 4B). Synonymous changes account for almost 10% of variants found only in the somatic genome and 2% of variants in the germline genome, post filtering (Supplementary Fig. 4B).
MEN1 variants could impact specific MENIN isoforms
Genomic variants in MEN1 were observed along the entire ORF, beginning at the initiator methionine and including the stop codon (Supplementary Table 3). We noted specific variants that could impact individual isoforms of MENIN. Several variants in the 15-nucleotide extension of exon 2* could result in missense changes or the acquisition of a stop codon in MENIN isoform 1 (Fig. 4C and Supplementary Table 3). In addition, variants affecting the splice donor site of exon 2 (e.g. NC_000011.10:g.64809665-64809663, Fig. 4C) and exon 3 (e.g. NC_000011.10:g.64807890-64807889, Fig. 4D) could destroy the canonical splice donor sites and force the use of exon 2* and exon 3* respectively, resulting in MENIN isoforms 1 and 4. Finally, we examined exon 7b and identified two deletions and one single nucleotide variant that could impact MENIN isoform 3 (Fig. 4E and Supplementary Table 3).
MEN1 variants have disparate functional effects
The role of MENIN as both a tumour suppressor and an oncogene in tumourigenesis underscores the importance of understanding the biological consequences of variants identified in MEN1. We collated published studies on the biological effects of MEN1 mutants to serve as a resource to guide future research. In total, we have curated 74 biological variables, including but not limited to promoter binding, transactivation potential and binding to other proteins (Supplementary Table 3). The best-characterised biological effect of MENIN variants is protein stability, having been investigated for 49 variants across multiple studies; about one-third of variants investigated (n = 14) were stable, with the remaining showing decreased protein stability.
Binding to JUND and subsequent repression of JUND transactivation potential and cooperativity with KMT2A have also been investigated (Supplementary Table 3). Roughly half of the variants investigated in the literature demonstrated strong binding to JUND (10/21) and KMT2A (4/7), with the remainder showing little interaction with the respective partners (Supplementary Table 2 and Table 1). Loss of binding correlated with loss of functional regulation by MENIN, but the reverse was not always true. For instance, both MENINL22R and MENINW436R (unstable variants) bound JUND with high affinity, but only the latter retained the ability to inhibit JUND-dependent reporter gene expression (Table 1). In addition, MENINL22R bound KMT2A but not the obligate COMPASS partner LEDGF (Yokoyama & Cleary 2008), yet demonstrated high methyl transferase activity on recombinant H3 (Table 1). Unsurprisingly, MENIN variants with no methyl transferase activity (e.g. MENINH139D and MENINA242V) could not catalyse H3K4me3 of the Hoxc8 promoter or induce Hoxc8 expression despite binding the cognate promoter (Table 1).
Summary of selected biological features for specific MEN1 variants reported in the literature. Derived and summarised from Supplementary Table 3.
| Variant | Stability | JUND binding | Inhibiting JUND trans-activation | KMT2A binding | LEDGF binding | NMHC II-A binding | H3 methyl transferase activity (in vitro) | Hoxc8 promoter binding | Hoxc8 promoter H3K4me3 | Induction of Hoxc8 expression | H4 methylation |
|---|---|---|---|---|---|---|---|---|---|---|---|
| WT | Stable | High | Yes | High | High | High | High | High | High | High | High |
| L22R | Unstable | High | No | High | Low | None | High | Mod | – | No | None |
| H139D | Unstable | None | No | None | None | None | None | Mod | Low | No | – |
| A242V | Stable | None | No | Mod | Low | High | None | Mod | Low | No | None |
| W436R | Unstable | High | Yes | High | High | High | Mod | – | – | – | – |
–, no data available.
Men1 variants in the general population could impact biological properties of MENIN
We noted that about 13% of variants catalogued (329/2574) were found in general population databases (gnomADg AF and gnomADe AF), with the majority (314/329) present at a frequency of less than 0.1%. Intriguingly, most of these variants were also identified in germline databases (LOVD and ClinVar) that report variants associated with MEN1 syndrome, and around a third (110/329) were reported as somatic variants (Supplementary Table 3). Of note, two variants reported in the general population, MENINR171Q and MENINR415Ter, are functionally impaired in their ability to suppress foci formation by LCT-10 cells compared to wildtype MENIN (Supplementary Table 3). We also note that MENINT344M, recently reported as a resistance mutation to MENIN-KMT2A inhibitors (Perner et al. 2023), is observed at low frequency in the general population (Supplementary Table 3).
Discussion
Although one of the earliest cancer-associated genes identified, the biology of MEN1 remains poorly understood. Herein, we highlight the role for alternative splicing in generating MENIN isoform diversity that could be functionally relevant both in normal tissues and during oncogenesis. With emerging recognition of the importance of noncanonical ORFs in health and disease (Chen et al. 2020), further characterisation of MENIN isoforms is warranted. We also highlight several mutants that we propose should be investigated in parallel to better clarify MENIN function.
MEN1 is broadly expressed and undergoes dynamic alternative splicing
Previous studies demonstrated broad MEN1 expression in embryonic and adult tissues in man (Lemmens et al. 1997, Wautot et al. 2000) and mice (Stewart et al. 1998, Bassett et al. 1999, Guru et al. 1999), with transcripts of variable lengths noted in human, mouse, rat and Drosophila (Lemmens et al. 1997, Stewart et al. 1998, Bassett et al. 1999, Guru et al. 1999, Karges et al. 1999, Guru et al. 2001). Expanding these observations, we have demonstrated that MEN1 is expressed in all human tissues examined in GETEx and have identified three sources of transcript diversity – alternative transcription start sites as previously reported (Fromaget et al. 2003), significant intron retention and alternative splicing of exons. Intron retention is seen in over 80% of protein-coding genes (Middleton et al. 2017) and affects several introns of MEN1. Given the mapped size of the MEN1 gene (approximately 6.8 kb), it is likely that intron retention accounts for some of the longer transcripts previously observed by Northern blot analysis (Lemmens et al. 1997).
We noted extensive alternative splicing of exons along the entire length of MEN1, including previously reported alternative splicing of 5’ UTR exons (Karges et al. 1999, Khodaei-O'Brien et al. 2000, Forsberg et al. 2001) and the use of exons 2* (Chandrasekharappa and Teh 2003) and 3* (see below). In addition, we also provide multiple lines of evidence to support the use of a novel exon, exon 7b. The broad tissue expression supports a physiological role for MEN1 in almost all tissues and is consistent with the fact that conventional deletion of Men1 is embryonic lethal in mice (Crabtree et al. 2001), but it leaves open the question of why the pathological effects of MEN1 in cancer manifest in a more restricted set of tissues. We suggest that alternative isoform expression could play a role in this tissue bias. In support of this, the variable read depth of sequences spanning MEN1 splice junctions in GTEx suggests dynamic MEN1 isoform expression across tissues. We deduce that the most abundant transcript encodes MENIN isoform 2, the 610 amino acid protein. However, we also infer that the use of exon 7b is relatively high in tissues such as the small intestine, liver and thyroid, while other alternative splicing events were lower but still detectable. Furthermore, there remain uncharacterised MEN1 variants in vivo, given that we amplified an uncharacterised 400 bp fragment across exons 7 and 8. We support MENIN isoform 2 being regarded as the reference isoform for this gene because of its broad and abundant tissue expression and the wealth of literature pertinent to this isoform.
Alternative splicing of MEN1 may generate protein isoforms with altered function
The consequences of altered 5’ exon use and intron retention for MEN1 remain to be functionally characterised, with effects on ribosome recruitment and translation (Chen et al. 2017, Hollerer et al. 2019) possible. However, we predict that alternative splicing of protein coding exons and intervening introns could also be an unexpected source of isoform diversity. While the inclusion of introns can result in nonsense-mediated mRNA decay or altered splicing rates (Monteuuis et al. 2019), they could also provide alternative initiator methionine for the translation of the C-terminal of MENIN but with unique N-termini, as has been reported in yeast (Hossain et al. 2016).
We predict that alternative splicing of protein-coding exons generates remarkable diversity in MENIN with diverse protein functions in vivo. Isoforms 1 and 4 would have alterations in the thumb domain, while isoform 3 has an insertion in the palm domain of MENIN. Given that protein interaction interfaces occur along the entire length of the protein, it is likely that the different isoforms have different biological functions. In support of this, isoform 4, which lacks a portion of MENIN that includes the SMAD3 binding interface (Fig. 3), cannot bind SMAD3 or support SMAD3-dependent reporter gene expression (Canaff et al. 2012).
Genomic variants in MEN1 in cancer have altered protein function and could impact MENIN isoform expression
We have catalogued 2574 unique MEN1 variants in public databases up to June 2023. The majority were reported in germline compared to somatic genomes, similar to previous studies (Lemos & Thakker 2008, Nelakurti et al. 2020). The reason for this bias is unknown but raises the possibility of negative selection of mutations in MEN1 in somatic cancers and hints at an oncogenic role for MENIN there, in contrast to its tumour-suppressive role in MEN1 syndrome. We note that pan-cancer analyses indicate preferential accumulation of synonymous mutations in oncogenes over tumour suppressor genes (Supek et al. 2014) at frequencies similar to what we observe for MEN1 in somatic samples here.
Reported variants in MEN1 occur along the entire length of the gene, including in exons 2* and 7b that are unique to MENIN isoforms 1 and 3 respectively. A significant proportion of patients presenting with MEN1 syndrome currently do not have germline mutations identified (Lemos & Thakker 2008). Although clinical overlap with other cancer syndromes could account for a proportion of these, variants in currently unscreened genomic regions of MEN1 could explain other cases. One third of the variants identified in MEN1 would result in the introduction of a premature stop codon in MENIN. While such truncating variants would intuitively be expected to result in the loss of portions of the carboxy terminal and thus affect protein function (Ikeo et al. 2004, Duan et al. 2023), protein instability and degradation by the proteasome is also a common outcome in MENIN (Shimazu et al. 2011).
The functional consequences of missense variants, which make up 50% of variants in MEN1, are more varied. A comprehensive review of the literature identified 74 biological variables for MENIN, with the most studied variables being protein stability and interactions with JUND and KMT2A. MENIN missense variants display a combination of responses to these variables (Supplementary Table 3). Such complexity highlights both the gaps and challenges of understanding MENIN biology in cancer. While the sheer number of variants in MEN1 can make addressing this challenge a daunting prospect, we believe that reducing this to a smaller cohort with complementary biological outcomes is a reasonable strategy to prioritise variants for future research. Reflecting the diversity of biological outcomes in protein stability, protein–protein interactions, and histone methylation (Table 1), we propose that MENINL22R, MENINH139D, MENINA242V and MENINW436R could form a limited set of pathogenic MEN1 variants that are investigated together to dissect a wider array of functional effects of MENIN.
We believe that aberrant exon use, and subsequent isoform expression, is a key contributor to altered MEN1 function in cancer. Almost 7% of MEN1 variants in our study are predicted to alter splicing. Variants that disrupt canonical splice sites can promote alternative exon use, and indeed, mutations affecting the splice donor site of intron 3 of MEN1 are known to favour the use of exon 3* in cells (Hai et al. 2000, Canaff et al. 2012, Karges et al. 2000). We have curated several variants that may similarly promote the use of exons 2* and 3*. Of importance, 10% of exonic variants in the Human Gene Mutation Database promote alternative exon splicing (Soemedi et al. 2017), suggesting that alternative splicing of MEN1 in oncogenesis may be more widespread than appreciated.
It is generally accepted that the penetrance of MEN1 variants in MEN1 syndrome is high, with over 90% of individuals reporting some manifestation of the syndrome (Brandi et al. 2021). Thus, it is intriguing that a small, but significant, number of variants curated in this study were present in the general population database gnomAD at low frequencies. Limited functional data exist for these variants, but two have compromised biological activity. It remains to be resolved whether time and/or modifiers are required for oncogenesis for potentially low penetrance MEN1 variants in the general population. Given that at least one of these variants confers resistance to small molecule inhibitors, pharmacogenetics of MEN1 may be of clinical importance in cancer care.
One limitation of our current work is that it has involved the analysis of short-read sequencing data. While informative, the identity of MEN1 isoforms can only be inferred at this stage; long-read sequencing is needed to accurately identify isoform expression in vivo.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/EO-24-0014.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The project was supported by the Translational Medicine Trust and the Maurice and Phyllis Paykel Trust.
References
Agarwal SK, Guru SC, Heppner C, Erdos MR, Collins RM, Park SY, Saggar S, Chandrasekharappa SC, Collins FS, Spiegel AM, et al.1999 Menin interacts with the AP1 transcription factor JunD and represses JunD-activated transcription. Cell 96 143–152. (https://doi.org/10.1016/s0092-8674(00)80967-8)
Bassett JH, Rashbass P, Harding B, Forbes SA, Pannett AA & & Thakker RV 1999 Studies of the murine homolog of the multiple endocrine neoplasia type 1 (MEN1) gene, men1. Journal of Bone and Mineral Research 14 3–10. (https://doi.org/10.1359/jbmr.1999.14.1.3)
Bertolino P, Tong WM, Galendo D, Wang ZQ & & Zhang CX 2003a Heterozygous Men1 mutant mice develop a range of endocrine tumors mimicking multiple endocrine neoplasia type 1. Molecular Endocrinology 17 1880–1892. (https://doi.org/10.1210/me.2003-0154)
Bertolino P, Tong WM, Herrera PL, Casse H, Zhang CX & & Wang ZQ 2003b Pancreatic beta-cell-specific ablation of the multiple endocrine neoplasia type 1 (MEN1) gene causes full penetrance of insulinoma development in mice. Cancer Research 63 4836–4841)
Biondi CA, Gartside MG, Waring P, Loffler KA, Stark MS, Magnuson MA, Kay GF & & Hayward NK 2004 Conditional inactivation of the MEN1 gene leads to pancreatic and pituitary tumorigenesis but does not affect normal development of these tissues. Molecular and Cellular Biology 24 3125–3131. (https://doi.org/10.1128/MCB.24.8.3125-3131.2004)
Brandi ML, Agarwal SK, Perrier ND, Lines KE, Valk GD & & Thakker RV 2021 Multiple endocrine neoplasia type 1: latest insights. Endocrine Reviews 42 133–170. (https://doi.org/10.1210/endrev/bnaa031)
Canaff L, Vanbellinghen JF, Kaji H, Goltzman D & & Hendy GN 2012 Impaired transforming growth factor-beta (TGF-beta) transcriptional activity and cell proliferation control of a menin in-frame deletion mutant associated with multiple endocrine neoplasia type 1 (MEN1). Journal of Biological Chemistry 287 8584–8597. (https://doi.org/10.1074/jbc.M112.341958)
Cao Y, Liu R, Jiang X, Lu J, Jiang J, Zhang C, Li X & & Ning G 2009 Nuclear-cytoplasmic shuttling of menin regulates nuclear translocation of {beta}-catenin. Molecular and Cellular Biology 29 5477–5487. (https://doi.org/10.1128/MCB.00335-09)
Cenik BK & & Shilatifard A 2021 COMPASS and SWI/SNF complexes in development and disease. Nature Reviews 22 38–58. (https://doi.org/10.1038/s41576-020-0278-0)
Chandrasekharappa SC, Guru SC, Manickam P, Olufemi SE, Collins FS, Emmert-Buck MR, Debelenko LV, Zhuang Z, Lubensky IA, Liotta LA, et al.1997 Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science 276 404–407. (https://doi.org/10.1126/science.276.5311.404)
Chandrasekharappa SC & & Teh BT 2003 Functional studies of the MEN1 gene. Journal of Internal Medicine 253 606–615. (https://doi.org/10.1046/j.1365-2796.2003.01165.x)
Chen J, Brunner AD, Cogan JZ, Nunez JK, Fields AP, Adamson B, Itzhak DN, Li JY, Mann M, Leonetti MD, et al.2020 Pervasive functional translation of noncanonical human open reading frames. Science 367 1140–1146. (https://doi.org/10.1126/science.aay0262)
Chen J, Tresenrider A, Chia M, Mcswiggen DT, Spedale G, Jorgensen V, Liao H, Van Werven FJ & & Unal E 2017 Kinetochore inactivation by expression of a repressive mRNA. eLife 6. (https://doi.org/10.7554/eLife.27417)
Crabtree JS, Scacheri PC, Ward JM, Garrett-Beal L, Emmert-Buck MR, Edgemon KA, Lorang D, Libutti SK, Chandrasekharappa SC, Marx SJ, et al.2001 A mouse model of multiple endocrine neoplasia, type 1, develops multiple endocrine tumors. PNAS 98 1118–1123. (https://doi.org/10.1073/pnas.98.3.1118)
Crabtree JS, Scacheri PC, Ward JM, Mcnally SR, Swain GP, Montagna C, Hager JH, Hanahan D, Edlund H, Magnuson MA, et al.2003 Of mice and MEN1: insulinomas in a conditional mouse knockout. Molecular and Cellular Biology 23 6075–6085. (https://doi.org/10.1128/MCB.23.17.6075-6085.2003)
Duan S, Sheriff S, Elvis-Offiah UB, Witten BL, Sawyer TW, Sundaresan S, Cierpicki T, Grembecka J & & Merchant JL 2023 Clinically defined mutations in MEN1 alter its tumor-suppressive function through increased Menin turnover. Cancer Research Communications 3 1318–1334. (https://doi.org/10.1158/2767-9764.CRC-22-0522)
Forsberg L, Zablewska B, Piehl F, Weber G, Lagercrantz S, Gaudray P, Hoog C & & Larsson C 2001 Differential expression of multiple alternative spliceforms of the Men1 tumor suppressor gene in mouse. International Journal of Molecular Medicine 8 681–689. (https://doi.org/10.3892/ijmm.8.6.681)
Freeman PJ, Hart RK, Gretton LJ, Brookes AJ & & Dalgleish R 2018 VariantValidator: accurate validation, mapping, and formatting of sequence variation descriptions. Human Mutation 39 61–68. (https://doi.org/10.1002/humu.23348)
Fromaget M, Vercherat C, Zhang CX, Zablewska B, Gaudray P, Chayvialle JA, Calender A & & Cordier-Bussat M 2003 Functional characterization of a promoter region in the human MEN1 tumor suppressor gene. Journal of Molecular Biology 333 87–102. (https://doi.org/10.1016/j.jmb.2003.08.001)
Gillam MP, Nimbalkar D, Sun L, Christov K, Ray D, Kaldis P, Liu X & & Kiyokawa H 2015 MEN1 tumorigenesis in the pituitary and pancreatic islet requires Cdk4 but not Cdk2. Oncogene 34 932–938. (https://doi.org/10.1038/onc.2014.3)
GTEx Consortium 2013 The Genotype-Tissue Expression (GTEx) project. Nature Genetics 45 580–585. (https://doi.org/10.1038/ng.2653)
Guru SC, Goldsmith PK, Burns AL, Marx SJ, Spiegel AM, Collins FS & & Chandrasekharappa SC 1998 Menin, the product of the MEN1 gene, is a nuclear protein. PNAS 95 1630–1634. (https://doi.org/10.1073/pnas.95.4.1630)
Guru SC, Crabtree JS, Brown KD, Dunn KJ, Manickam P, Prasad NB, Wangsa D, Burns AL, Spiegel AM, Marx SJ, et al.1999 Isolation, genomic organization, and expression analysis of Men1, the murine homolog of the MEN1 gene. Mammalian Genome 10 592–596. (https://doi.org/10.1007/s003359901051)
Guru SC, Prasad NB, Shin EJ, Hemavathy K, Lu J, Ip YT, Agarwal SK, Marx SJ, Spiegel AM, Collins FS, et al.2001 Characterization of a MEN1 ortholog from Drosophila melanogaster. Gene 263 31–38. (https://doi.org/10.1016/s0378-1119(00)00562-x)
Hai N, Aoki N, Shimatsu A, Mori T & & Kosugi S 2000 Clinical features of multiple endocrine neoplasia type 1 (MEN1) phenocopy without germline MEN1 gene mutations: analysis of 20 Japanese sporadic cases with MEN1. Clinical Endocrinology 52 509–518. (https://doi.org/10.1046/j.1365-2265.2000.00966.x)
Harding B, Lemos MC, Reed AAC, Walls GV, Jeyabalan J, Bowl MR, Tateossian H, Sullivan N, Hough T, Fraser WD, et al.2009 Multiple endocrine neoplasia type 1 knockout mice develop parathyroid, pancreatic, pituitary and adrenal tumours with hypercalcaemia, hypophosphataemia and hypercorticosteronaemia. Endocrine-Related Cancer 16 1313–1327. (https://doi.org/10.1677/ERC-09-0082)
Heppner C, Kester MB, Agarwal SK, Debelenko LV, Emmert-Buck MR, Guru SC, Manickam P, Olufemi SE, Skarulis MC, Doppman JL, et al.1997 Somatic mutation of the MEN1 gene in parathyroid tumours. Nature Genetics 16 375–378. (https://doi.org/10.1038/ng0897-375)
Hessman O, Lindberg D, Skogseid B, Carling T, Hellman P, Rastad J, Akerstrom G & & Westin G 1998 Mutation of the multiple endocrine neoplasia type 1 gene in nonfamilial, malignant tumors of the endocrine pancreas. Cancer Research 58 377–379.
Hollerer I, Barker JC, Jorgensen V, Tresenrider A, Dugast-Darzacq C, Chan LY, Darzacq X, Tjian R, Unal E & & Brar GA 2019 Evidence for an integrated gene repression mechanism based on mRNA isoform toggling in human cells. G3 9 1045–1053. (https://doi.org/10.1534/g3.118.200802)
Hossain MA, Claggett JM, Edwards SR, Shi A, Pennebaker SL, Cheng MY, Hasty J & & Johnson TL 2016 Posttranscriptional regulation of Gcr1 expression and activity is crucial for metabolic adjustment in response to glucose availability. Molecular Cell 62 346–358. (https://doi.org/10.1016/j.molcel.2016.04.012)
Huang J, Gurung B, Wan B, Matkar S, Veniaminova NA, Wan K, Merchant JL, Hua X & & Lei M 2012 The same pocket in menin binds both MLL and JUND but has opposite effects on transcription. Nature 482 542–546. (https://doi.org/10.1038/nature10806)
Ikeo Y, Yumita W, Sakurai A & & Hashizume K 2004 JunD-menin interaction regulates c-Jun-mediated AP-1 transactivation. Endocrine Journal 51 333–342. (https://doi.org/10.1507/endocrj.51.333)
Karges W, Jostarndt K, Maier S, Flemming A, Weitz M, Wissmann A, Feldmann B, Dralle H, Wagner P & & Boehm BO 2000 Multiple endocrine neoplasia type 1 (MEN1) gene mutations in a subset of patients with sporadic and familial primary hyperparathyroidism target the coding sequence but spare the promoter region. Journal of Endocrinology 166 1–9. (https://doi.org/10.1677/joe.0.1660001)
Karges W, Maier S, Wissmann A, Dralle H, Dosch HM & & Boehm BO 1999 Primary structure, gene expression and chromosomal mapping of rodent homologs of the MEN1 tumor suppressor gene. Biochimica et Biophysica Acta 1446 286–294. (https://doi.org/10.1016/s0167-4781(99)00089-5)
Karnik SK, Hughes CM, Gu X, Rozenblatt-Rosen O, Mclean GW, Xiong Y, Meyerson M & & Kim SK 2005 Menin regulates pancreatic islet growth by promoting histone methylation and expression of genes encoding p27Kip1 and p18INK4c. PNAS 102 14659–14664. (https://doi.org/10.1073/pnas.0503484102)
Khodaei-O'brien S, Zablewska B, Fromaget M, Bylund L, Weber G & & Gaudray P 2000 Heterogeneity at the 5'-end of MEN1 transcripts. Biochemical and Biophysical Research Communications 276 508–514. (https://doi.org/10.1006/bbrc.2000.3471)
La P, Desmond A, Hou Z, Silva AC, Schnepp RW & & Hua X 2006 Tumor suppressor menin: the essential role of nuclear localization signal domains in coordinating gene expression. Oncogene 25 3537–3546. (https://doi.org/10.1038/sj.onc.1209400)
Larsson C, Skogseid B, Oberg K, Nakamura Y & & Nordenskjold M 1988 Multiple endocrine neoplasia type 1 gene maps to chromosome 11 and is lost in insulinoma. Nature 332 85–87. (https://doi.org/10.1038/332085a0)
Lawrence B, Blenkiron C, Parker K, Tsai P, Fitzgerald S, Shields P, Robb T, Yeong ML, Kramer N, James S, et al.2018 Recurrent loss of heterozygosity correlates with clinical outcome in pancreatic neuroendocrine cancer. npj Genomic Medicine 3 18. (https://doi.org/10.1038/s41525-018-0058-3)
Lemmens I, Van De Ven WJ, Kas K, Zhang CX, Giraud S, Wautot V, Buisson N, De Witte K, Salandre J, Lenoir G, et al.1997 Identification of the multiple endocrine neoplasia type 1 (MEN1) gene. The European Consortium on MEN1. Human Molecular Genetics 6 1177–1183. (https://doi.org/10.1093/hmg/6.7.1177)
Lemos MC & & Thakker RV 2008 Multiple endocrine neoplasia type 1 (MEN1): analysis of 1336 mutations reported in the first decade following identification of the gene. Human Mutation 29 22–32. (https://doi.org/10.1002/humu.20605)
Li F, Su Y, Cheng Y, Jiang X, Peng Y, Li Y, Lu J, Gu Y, Zhang C, Cao Y, et al.2015 Conditional deletion of Men1 in the pancreatic beta-cell leads to glucagon-expressing tumor development. Endocrinology 156 48–57. (https://doi.org/10.1210/en.2014-1433)
Libutti SK, Crabtree JS, Lorang D, Burns AL, Mazzanti C, Hewitt SM, O’connor S, Ward JM, Emmert-Buck MR, Remaley A, et al.2003 Parathyroid gland-specific deletion of the mouse Men1 gene results in parathyroid neoplasia and hypercalcemic hyperparathyroidism. Cancer Research 63 8022–8028.
Loffler KA, Biondi CA, Gartside M, Waring P, Stark M, Serewko-Auret MM, Muller HK, Hayward NK & & Kay GF 2007 Broad tumor spectrum in a mouse model of multiple endocrine neoplasia type 1. International Journal of Cancer 120 259–267. (https://doi.org/10.1002/ijc.22288)
Lu J, Herrera PL, Carreira C, Bonnavion R, Seigne C, Calender A, Bertolino P & & Zhang CX 2010 Alpha cell-specific Men1 ablation triggers the transdifferentiation of glucagon-expressing cells and insulinoma development. Gastroenterology 138 1954–1965. (https://doi.org/10.1053/j.gastro.2010.01.046)
Martin FJ, Amode MR, Aneja A, Austine-Orimoloye O, Azov AG, Barnes I, Becker A, Bennett R, Berry A, Bhai J, et al.2023 Ensembl 2023. Nucleic Acids Research 51 D933–D941. (https://doi.org/10.1093/nar/gkac958)
Middleton R, Gao D, Thomas A, Singh B, Au A, Wong JJL, Bomane A, Cosson B, Eyras E, Rasko JEJ, et al.2017 IRFinder: assessing the impact of intron retention on mammalian gene expression. Genome Biology 18 51. (https://doi.org/10.1186/s13059-017-1184-4)
Milan T, Celton M, Lagace K, Roques É, Safa-Tahar-Henni S, Bresson E, Bergeron A, Hebert J, Meshinchi S, Cellot S, et al.2022 Epigenetic changes in human model KMT2A leukemias highlight early events during leukemogenesis. Haematologica 107 86–99. (https://doi.org/10.3324/haematol.2020.271619)
Milne TA, Hughes CM, Lloyd R, Yang Z, Rozenblatt-Rosen O, Dou Y, Schnepp RW, Krankel C, Livolsi VA, Gibbs D, et al.2005 Menin and MLL cooperatively regulate expression of cyclin-dependent kinase inhibitors. PNAS 102 749–754. (https://doi.org/10.1073/pnas.0408836102)
Monteuuis G, Wong JJL, Bailey CG, Schmitz U & & Rasko JEJ 2019 The changing paradigm of intron retention: regulation, ramifications and recipes. Nucleic Acids Research 47 11497–11513. (https://doi.org/10.1093/nar/gkz1068)
Morales J, Pujar S, Loveland JE, Astashyn A, Bennett R, Berry A, Cox E, Davidson C, Ermolaeva O, Farrell CM, et al.2022 A joint NCBI and EMBL-EBI transcript set for clinical genomics and research. Nature 604 310–315. (https://doi.org/10.1038/s41586-022-04558-8)
Murai MJ, Chruszcz M, Reddy G, Grembecka J & & Cierpicki T 2011 Crystal structure of menin reveals binding site for mixed lineage leukemia (MLL) protein. Journal of Biological Chemistry 286 31742–31748. (https://doi.org/10.1074/jbc.M111.258186)
Nelakurti DD, Pappula AL, Rajasekaran S, Miles WO & & Petreaca RC 2020 Comprehensive analysis of MEN1 mutations and their role in cancer. Cancers 12. (https://doi.org/10.3390/cancers12092616)
Patel P, O'rahilly S, Buckle V, Nakamura Y, Turner RC & & Wainscoat JS 1990 Chromosome 11 allele loss in sporadic insulinoma. Journal of Clinical Pathology 43 377–378. (https://doi.org/10.1136/jcp.43.5.377)
Perner F, Stein EM, Wenge DV, Singh S, Kim J, Apazidis A, Rahnamoun H, Anand D, Marinaccio C, Hatton C, 2023. MEN1 mutations mediate clinical resistance to menin inhibition. Nature 615 913–919)
Scacheri PC, Crabtree JS, Kennedy AL, Swain GP, Ward JM, Marx SJ, Spiegel AM & & Collins FS 2004 Homozygous loss of menin is well tolerated in liver, a tissue not affected in MEN1. Mammalian Genome 15 872–877. (https://doi.org/10.1007/s00335-004-2395-z)
Scacheri PC, Davis S, Odom DT, Crawford GE, Perkins S, Halawi MJ, Agarwal SK, Marx SJ, Spiegel AM, Meltzer PS, et al.2006 Genome-wide analysis of menin binding provides insights into MEN1 tumorigenesis. PLoS Genetics 2 e51. (https://doi.org/10.1371/journal.pgen.0020051)
Scarpa A, Chang DK, Nones K, Corbo V, Patch AM, Bailey P, Lawlor RT, Johns AL, Miller DK, Mafficini A, et al.2017 Whole-genome landscape of pancreatic neuroendocrine tumours. Nature 543 65–71.
Schnepp RW, Chen YX, Wang H, Cash T, Silva A, Diehl JA, Brown E & & Hua X 2006 Mutation of tumor suppressor gene Men1 acutely enhances proliferation of pancreatic islet cells. Cancer Research 66 5707–5715. (https://doi.org/10.1158/0008-5472.CAN-05-4518)
Shen HCJ, He M, Powell A, Adem A, Lorang D, Heller C, Grover AC, Ylaya K, Hewitt SM, Marx SJ, et al.2009 Recapitulation of pancreatic neuroendocrine tumors in human multiple endocrine neoplasia type I syndrome via Pdx1-directed inactivation of Men1. Cancer Research 69 1858–1866. (https://doi.org/10.1158/0008-5472.CAN-08-3662)
Shen HCJ, Ylaya K, Pechhold K, Wilson A, Adem A, Hewitt SM & & Libutti SK 2010 Multiple endocrine neoplasia type 1 deletion in pancreatic alpha-cells leads to development of insulinomas in mice. Endocrinology 151 4024–4030. (https://doi.org/10.1210/en.2009-1251)
Shi A, Murai MJ, He S, Lund G, Hartley T, Purohit T, Reddy G, Chruszcz M, Grembecka J & & Cierpicki T 2012 Structural insights into inhibition of the bivalent menin-MLL interaction by small molecules in leukemia. Blood 120 4461–4469. (https://doi.org/10.1182/blood-2012-05-429274)
Shimazu S, Nagamura Y, Yaguchi H, Ohkura N & & Tsukada T 2011 Correlation of mutant menin stability with clinical expression of multiple endocrine neoplasia type 1 and its incomplete forms. Cancer Science 102 2097–2102. (https://doi.org/10.1111/j.1349-7006.2011.02055.x)
Soemedi R, Cygan KJ, Rhine CL, Wang J, Bulacan C, Yang J, Bayrak-Toydemir P, Mcdonald J & & Fairbrother WG 2017 Pathogenic variants that alter protein code often disrupt splicing. Nature Genetics 49 848–855. (https://doi.org/10.1038/ng.3837)
Stewart C, Parente F, Piehl F, Farnebo F, Quincey D, Silins G, Bergman L, Carle GF, Lemmens I, Grimmond S, et al.1998 Characterization of the mouse Men1 gene and its expression during development. Oncogene 17 2485–2493. (https://doi.org/10.1038/sj.onc.1202164)
Supek F, Minana B, Valcarcel J, Gabaldon T & & Lehner B 2014 Synonymous mutations frequently act as driver mutations in human cancers. Cell 156 1324–1335. (https://doi.org/10.1016/j.cell.2014.01.051)
Thakker RV 2010 Multiple endocrine neoplasia type 1 (MEN1). Best Practice and Research 24 355–370. (https://doi.org/10.1016/j.beem.2010.07.003)
Wang EH, Ebrahimi SA, Wu AY, Kashefi C, Passaro E, JR. & Sawicki MP 1998 Mutation of the MENIN gene in sporadic pancreatic endocrine tumors. Cancer Research 58 4417–4420.
Wautot V, Khodaei S, Frappart L, Buisson N, Baro E, Lenoir GM, Calender A, Zhang CX & & Weber G 2000 Expression analysis of endogenous menin, the product of the multiple endocrine neoplasia type 1 gene, in cell lines and human tissues. International Journal of Cancer 85 877–881. (https://doi.org/10.1002/(sici)1097-0215(20000315)85:6<877::aid-ijc23>3.0.co;2-f)
Yang Y, Gurung B, Wu T, Wang H, Stoffers DA & & Hua X 2010 Reversal of preexisting hyperglycemia in diabetic mice by acute deletion of the Men1 gene. PNAS 107 20358–20363. (https://doi.org/10.1073/pnas.1012257107)
Yokoyama A & & Cleary ML 2008 Menin critically links MLL proteins with LEDGF on cancer-associated target genes. Cancer Cell 14 36–46. (https://doi.org/10.1016/j.ccr.2008.05.003)
Yokoyama A, Somervaille TCP, Smith KS, Rozenblatt-Rosen O, Meyerson M & & Cleary ML 2005 The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis. Cell 123 207–218. (https://doi.org/10.1016/j.cell.2005.09.025)
Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I, Herr W & & Cleary ML 2004 Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex with menin to regulate Hox gene expression. Molecular and Cellular Biology 24 5639–5649. (https://doi.org/10.1128/MCB.24.13.5639-5649.2004)
Zhuang Z, Ezzat SZ, Vortmeyer AO, Weil R, Oldfield EH, Park WS, Pack S, Huang S, Agarwal SK, Guru SC, et al.1997a Mutations of the MEN1 tumor suppressor gene in pituitary tumors. Cancer Research 57 5446–5451.
Zhuang Z, Vortmeyer AO, Pack S, Huang S, Pham TA, Wang C, Park WS, Agarwal SK, Debelenko LV, Kester M, et al.1997b Somatic mutations of the MEN1 tumor suppressor gene in sporadic gastrinomas and insulinomas. Cancer Research 57 4682–4686.
